Conus textile TeA21P mRNA, partial cds (N00977) Nucleic Acid Card

General Information
Name Conus textile TeA21P mRNA, partial cds
Organism Conus textile (Cloth-of-gold cone)
Organism Diet molluscivorous
Organism Clade V
Organism Region Indo-Pacific
Notes

Sequence
tctgatggcaggaatgacgcagccaaagcgtctggcctgg
tcagtctgactgacaggagaccagaatgctgtagtgatcc
tcgctgtaactcgagtcatccagaactttgtggt
tgacga
cgctgatgctccaggaccctctgaaccacga
Sequence translation SDGRNDAAKASGLVSLTDRRPECCSDPRCNSSHPELCG

References
Luo,S., Zhangsun,D., Zhang,B., Quan,Y. and Wu,Y. (2006) Novel alpha-conotoxins identified by gene sequencing from cone snails native to Hainan, and their sequence diversity J. Pept. Sci. 12:693-704

Internal links
Proteins Encoded Tx1 precursor

External links
Ncbi
GenBank DQ141135

Tools