Conus textile conotoxin Gla-TxXI precursor, mRNA, complete cds (N00847) Nucleic Acid Card

General Information
Name Conus textile conotoxin Gla-TxXI precursor, mRNA, complete cds
Organism Conus textile (Cloth-of-gold cone)
Organism Diet molluscivorous
Organism Clade V
Organism Region Indo-Pacific
Notes

Sequence
cgcccgggcaggtcttgaacagcacacgagggccctaaac
gggaagagtaagatcagagaggcagagaagtgacggagat
caacggtgaaag
atggttcgtgtcacgtctgtcggctgtt
tcctgctggtcatcgtttctctgaacttggttgtgcttac
caatgcctgcattcctgaaggatcgtcctgcagttctagt
ggcagttgctgtcacaagagttgctgtcgttggacctgca
atcaaccgtgtctaattcctgggaagagggcgaaactcct
agaattctttcgacaacgt
tgatatgttgcccagagttct
gctgcttttcttcgtcaatggcagataactcaagcctgac
gtttctgcagttctttctccccatcttcttcttccttagc
ccctctcacctcctctccctcctcctccccgcaccatgct
aataaatttgatgctgcagaatc
Sequence translation MVRVTSVGCFLLVIVSLNLVVLTNACIPEGSSCSSSGSCC
HKSCCRWTCNQPCLIPGKRAKLLEFFRQR

References

Internal links
Proteins Encoded TxXI precursor

External links
Ncbi
GenBank AY856070

Tools