Conus striatus isolate S1.8 superfamily conotoxin gene, complete cds. (N01723) Nucleic Acid Card

General Information
Name Conus striatus isolate S1.8 superfamily conotoxin gene, complete cds.
Organism Conus striatus (Striated cone)
Organism Diet piscivorous
Organism Clade I
Organism Region Indo-Pacific
Notes

Sequence
ggatcc
atgttcaccgtgtttctgttggttgtcttggcaa
ccactgtcgtttccttcacttcagatcgtgcatctgatgg
cagggatgacgaagccaaagacgaaaggtctgacatgcac
gaatcggaccggaaaggacgcgcatactgttgccatcctg
cctgtggcccaaactatagttgtggcacctcatgctccag
gaccctctga
accacgacctcgag
Sequence translation MFTVFLLVVLATTVVSFTSDRASDGRDDEAKDERSDMHES
DRKGRAYCCHPACGPNYSCGTSCSRTL-

References
Puillandre,N. and Olivera,B.M. (2010) Evolution of Conus Peptide Genes: Duplication and Positive Selection in the A-Superfamily. J Mol Evol

Internal links
Proteins Encoded S1.8 precursor

External links
Ncbi
GenBank FJ868104

Tools